Activate Now
 
ProHealth health Vitamin and Natural Supplement Store and Health
Home  |  Log In  |  My Account  |  View Cart  View Your ProHealth Vitamin and Supplement Shopping Cart
800-366-6056  |  Contact Us  |  Help
Facebook Google Plus
Fibromyalgia  Chronic Fatigue Syndrome & M.E.  Lyme Disease  Natural Wellness  Supplement News  Forums  Our Story
Store     Brands   |   A-Z Index   |   Best Sellers   |   New Products   |   Deals & Specials   |   Under $10   |   SmartSavings Club

Trending News

Patient Insights into the Design of Technology to Support a Strengths-Based Approach to Health Care.

SURVEY: Weight Management & Chronic Illness

Japanese green tea consumers have reduced risk of dementia

Do Nothing, Accomplish Everything! The Connection Between Breathing and Healing

Meet the ProHealth Editors

Best Herbs to Help With Insomnia

Nature Heals

Choline: Why You Should Eat Your Egg Yolks and Take Krill

Calcium, vitamin D supplementation associated improved stroke recovery

Acupressure reduced fatigue in breast cancer survivors

 
Print Page
Email Article

Decreased Nitric Oxide-Mediated Natural Killer Cell Activation in Chronic Fatigue Syndrome

  [ 6 votes ]   [ Discuss This Article ]
www.ProHealth.com • January 18, 2002




Ogawa, Nishiura, Yoshimura, Horikawa, Yoshida, Okajima, Matsumura, Ishikawa, Nakao, Tomiyama, Kanayama, Kanakura&Matsuzawa. European Journal of Clinical Investigation (Volume 28 Issue 11 Page 937 - November 1998)

Background

L-Arginine ( L-Arg), one of the essential amino acids, has been reported to have an immunomodulatory effect. The precise mechanism of the L-Arg-induced natural killer (NK) cell activation remains unresolved ,and the effect of L-Arg on NK cells in chronic fatigue syndrome (CFS) patients has not been estimated.

Methods

NK cell function was evaluated in 20 subjects with CFS and compared with that in 21 healthy individuals.

Results

In healthy control subjects, NK activity was significantly increased after treatment with L-Arg, an NK function enhancer, for 24 h, whereas the same treatment failed to enhance NK activity in the CFS patients. We thus focused on L-Arg metabolism, which involves nitric oxide (NO) production through NO synthase (NOS). The expression of inducible NO synthase (iNOS) transcripts in peripheral blood mononuclear cells was not significantly different between healthy control subjects and CFS patients. The L-Arg-mediated NK cell activation was abolished by addition of NG-monomethyl- L-arginine, an inhibitor for iNOS. Furthermore, incubation with S-nitroso-N-acetyl-penicillamine, an NO donor, stimulated NK activity in healthy control subjects but not in CFS patients.

Conclusion

These results demonstrate that the L-Arg-induced activation of NK activity is mediated by NO and that a possible dysfunction exists in the NO-mediated NK cell activation in CFS patients.

Complete Study:

Chronic fatigue syndrome (CFS) is characterized by a debilitating fatigue of unknown aetiology that lasts more than 6 months [ 1, 2]. The pathogenesis of CFS has not yet been determined. Earlier studies have shown that viral infections or a variety of immunological abnormalities have been reported to be associated with CFS. For example, enterovirus, retrovirus, Epstein-Barr (EB) virus and Borna virus have been reported to be associated with CFS [ 3-7], and immunological abnormalities including lymphocyte subsets, reduced mitogen response and altered cytokine production [ 8-10]. However, recent, better designed, studies have shown that these viral infections or a variety of immunological abnormalities, such as lymphocyte subsets and cytokine production, are unlikely to play a role in the development of CFS [ 11-13].

Natural killer lymphocytes (NK), which have non-major histocompatibility complex-restricted cytotoxicity to tumor cells, also participate in the immune defense system against a wide range of pathogens, especially viral infections [ 14]. Thus, the possibility exists that an NK dysfunction exists and persists in CFS patients, which may be responsible for some of the clinical observations [ 15]. In contrast, it has also been reported that the functionality of NK cells is increased or normal in CFS [ 16]. Recent studies have demonstrated that the NK cell is activated by various cytokines and other biological factors. L-Arginine ( L-Arg), an essential amino acid, has been reported to have an immunomodulatory effect [ 17] and is also capable of activating NK cell function [ 18].

Treatment of peripheral blood mononuclear cells (PBMCs) with L-Arg for 24 h stimulates NK activity in healthy volunteers [ 19]. L-Arg is known to be the physiological precursor of nitric oxide (NO) [ 20, 21]. The precise mechanism for this L-Arg-induced NK activation remains unresolved. As mentioned above, the existence of several immune disorders, including NK cytotoxicity, in CFS patients is controversial, but it is noteworthy that the effect of L-Arg on NK cytotoxicity has not been investigated in CFS patients to date.

In the present study, the mechanism by which pretreatment with L-Arg enhances NK activity in control subjects was investigated and CFS patients were compared with control subjects in terms of L-Arg-induced NK activity.

Our data indicate that the NK activation that arises by pretreatment of PBMCs with L-Arg is mediated by NO, and that in CFS patients L-Arg failed to enhance NK activity in vitro. The impaired activity in NK function was examined in relation to NO metabolism using an inhibitor of NO synthase (NOS), NG-monomethyl- L-arginine ( L-NMMA), and an NO donor, S-nitroso-N-acetylpenicillamine (SNAP) [ 22].

Patients

CFS patients consisted of 12 men and eight women, age range 19-34 years. They met the working case definition for CFS proposed by the Centers for Disease Control [ 1]. None of the patients had any history of other diseases known to be associated with fatigue. The patients had not received any medication known to modulate the immune system. The mean duration of the disease was 48 months with a range of 9 months to 180 months. The patient group was compared with healthy control subjects. The control group consisted of 14 healthy men and seven healthy women employed in various professions, age range 22-39 years, who had no evidence of any active infection or history of autoimmune or endocrine disorders. The measurements of NK activities of CFS patients and control subjects were performed at the same time.

Antibodies, reagents and cells

Fluorescein isothiocyanate (FITC)-conjugated mouse IgG1 (for isotype control) and monoclonal antibody (MAb) against CD3 (Leu-4) and phycoerythrin (PE)-conjugated mouse IgG1 (for isotype control) and MAb against CD56 (Leu-19) were purchased from Becton-Dickinson (Oxnard, CA, USA). Phenazine methosulphate, L-(+)-lactic acid, 2p-iodophenyl-3p-nitrophenyl tetrazolium chloride, nicotinamide, bovine serum albumin (BSA), L-arginine ( L-Arg), D-arginine ( D-Arg) and S-nitroso-N-acetyl-penicillamine (SNAP) were from Sigma (St Louis, MO, USA). NG-monomethyl- L-arginine ( L-NMMA) was purchased from Wako (Osaka, Japan). Fetal calf serum (FCS) and L-Arg-free cell culture media (RPMI-1640 Select-amine) were from Gibco (Gaithburg, MD, USA).

Other reagents were of the highest grade available. A human erythroleukaemia cell line K562 and human colon cancer cell line DLD-1 were obtained from the American Type Tissue Culture Collection (Rockville, MD, USA) and adapted for growth in RPMI-1640 (Biken; Osaka, Japan) supplemented with 10% heat-inactivated FCS and antibiotics in a humidified atmosphere of 5% CO2.

Preparation of PBMCs

Heparinized peripheral blood was drawn from CFS patients and control subjects after informed consent was given. PBMCs were isolated by Ficoll-Hypaque gradient centrifugation [ 23], washed three times with RPMI-1640, and resuspended in RPMI-1640 medium supplemented with 10% heat-inactivated FCS.

Flow cytometry

In two-color direct immunofluorescence, FITC-CD3 and PE-CD56 were used to determine the CD3 CD56+ lymphocyte subset [ 24]. After isolation, they were washed with phosphate-buffered saline (PBS) containing 0.1% NaN3, FITC- and PE-conjugated MAbs were added (5 mg L 1) and the suspension incubated for 30 min on ice. The cells were then washed twice with PBS and subjected to flow cytometry using a FACScan (Becton Dickinson). To exclude granulocytes, a live gate was set on lymphocytes and a total of 10 000 events were analyzed. Control fluorescence was determined using cells stained by FITC-G1CL and PE-G1CL.

Treatment with L-Arg or d-Arg

Isolated PBMCs were washed three times with PBS and cultured for 24 h with or without 30 mmol L 1L-Arg in RPMI-1640 supplemented with 10% heat-inactivated FCS at 37 °C in a humidified atmosphere of 5% CO2 as previously reported [ 19]. Medium containing 1 mmol L 1 or 30 mmol L 1D-Arg was also prepared using L-Arg-free RPMI-1640 and used as L-Arg replacing medium. After incubation, PBMCs were washed three times with PBS and the cytotoxicity assay was performed.

NK cytotoxicity Assay

The cytotoxicity assay was performed just before culturing and after a 24-h incubation in culture media alone (containing 1 mmol L 1L-Arg) or in the presence of 30 mmol L 1L-Arg. Cytotoxicity was evaluated by lactate dehydrogenase (LDH)-release assays [ 25], which were in good agreement with the standard 51Cr-release assay. In brief, 4 105 freshly isolated or cultured PBMCs were incubated in triplicate with 4 104 NK-sensitive K562 erythroleukaemia cells as targets in phenol red-free RPMI-1640 (Cosmo Bio; Tokyo, Japan) containing 2% BSA in a round-bottom 96-well microplate (an effector to target ratio = 10:1).

After 4-h incubation, the culture plates were centrifuged at 1100 rpm for 3 min, and the supernatant was collected from each well and transferred to flat-bottom 96-well microplates. The LDH substrate mixture, which contains L-(+)-lactic acid, 2p-iodophenyl-3p-nitrophenyl tetrazolium chloride, phenazine methosulphate and nicotinamide dinucleotide in 1 mol L 1 Tris-HCL, pH 8.0, was added to each cell-free supernatant. After exactly 5 min, the reaction was terminated by adding 1 mol L 1 HCl. LDH release was recorded with a microplate reader (Flow laboratories, Lugano, Switzerland) at an absorbance wavelength of 492 nm.

Cytotoxicity was calculated from the following formula:

where Exp is the experimental LDH release of co-cultured effector and target cells, Esp is the spontaneous LDH release of effector cells without target cells, Tsp is the spontaneous LDH release of target cells without effector cells, and Ttot is the maximal release of LDH, obtained by lysing target cells with 0.08% Triton X-100.

Detection of inducible NOS transcripts in PBMCs by RT-PCR

Total cellular RNA was isolated by the guanidinium/caesium chloride centrifugation method [ 26] from PBMCs of CFS patients or control subjects.

For reverse transcription-polymerase chain reaction (RT-PCR), 2.5 g of total cellular RNA was reverse transcribed at 37 °C for 60 min in a final volume of 50 L with 200 U of Moloney leukaemia virus reverse transcriptase (Gibco-BRL), 2 L of oligo-dT primers (2 mol L 1), 10 mmol L 1 dithiothreitol, 50 U of RNAsin (Toyobo, Osaka Japan) and 1 mmol L 1 of dNTP mix using the reaction buffer provided by the manufacturer.

The cDNA product (1.5 L) was resuspended in a total volume of 15 L containing 0.375 U of Taq DNA polymerase (Promega, Madison, WI, USA), 2 mmol L 1 MgCl2, 0.2 mmol L 1 dNTP mix, 15 pmol of forward and reverse primers, and 10 reaction buffer provided by the manufacturer. To amplify inducible NOS (iNOS) cDNA, 5 L of the resulting cDNA from a total of 50 L was PCR amplified in 20- L reactions using the forward primer (CTGTCCTTGGAAATTTCTGTT, nucleotides 212-232) in combination with reverse primers (TGGCCAGA GATGTTCCTCTATT, nucleotides 699-680) specific for the human hepatic iNOS cDNA as previously reported [ 27].

The primers for -actin that were used to show equal loading of RNA were forward, TCCTGTGGCATCCAC GAAACT; reverse, GAAGCATTTGCGGTGGACGAT; amplifying a 314-bp product. The PCR conditions were 15 s of denaturation at 95 °C, 30 s of annealing at 57 °C and 75 s of extension at 72°C for 35 cycles. The amplified products were analysed on a 1.5% agarose gel containing 0.5 mg L 1 ethidium bromide.

Cytokine Assays

PBMCs were suspended at 1-2 106 cells mL 1 with or without 30 mmol L 1L-Arg in RPMI-1640 supplemented with 10% heat-inactivated FCS and incubated at 37 °C for 24 h in 5% CO2. After centrifugation, the supernatants were quickly frozen and stored in aliquots at 80 °C until required. The interleukin 1 (IL-1 ) contents in the supernatants were determined using IL-1 ELISA kits (Cayman Chemical Company, Ann Arbor, MI, USA), and the interferon- (IFN- ) and the IL-2 contents in the supernatant were determined using ELISA kits (Otsuka Assay Laboratory, Osaka, Japan) according to the manufacturer's recommendations. High concentrations of L-Arg had no effect on the quantification of IL-1 , IFN- or IL-2.

Treatment with NOS inhibitor or NO donor

L-NMMA is a specific inhibitor of NO synthase [ 28]. PBMCs were incubated for 24 h at 37 °C in a medium containing 30 mmol L 1L-Arg in the presence or absence of 30 mmol L 1L-NMMA. PBMCs were also incubated for 24 h at 37 °C in the presence or absence of 10 mol L 1 SNAP, a NO donor. The PBMCs were washed three times with PBS and subjected to the NK cytotoxicity assay, as described above.

Statistical analysis

The results in this study were evaluated using the paired t-test.

Decrease in L-Arg-induced NK activation in CFS patients

We first examined the effect of a 24-h incubation of PBMCs with medium alone (the RPMI-1640 medium contained 1 mmol L 1L-Arg) on NK activity of control subjects and CFS patients. NK activity before treatment was 9.8% ± 2.8% (mean ± SD, n = 5) in control subjects and 9.7% ± 1.0% in CFS patients (n = 4) and after treatment was 10.1% ± 3.1% in control subjects and 9.8% ± 2.3% in CFS patients respectively. This preliminary examination indicated that a 24-h treatment of cells with medium (1 mmol L 1L-Arg) had no effect on NK activity in either the control subjects or the CFS patients. We next examined the effect of L-Arg on the NK activity in 20 CFS patients (12 men and eight women) and in 21 control subjects (14 men and seven women). After incubation for 24 h with medium alone (the RPMI-1640 medium contained 1 mmol L 1L-Arg), as shown in Fig. 1A and B, the NK activities of the control subjects and CFS patients were 10.7% ± 4.4% and 9.4% ± 8.0% respectively.

In contrast, a 24-h treatment with 30 mmol L 1L-Arg led to a significant increase in the NK activity of the control subjects, as previously reported by Park et al. [ 19] (1 mmol L 1L-Arg, 10.7% ± 4.4%; 30 mmol L 1 L-Arg, 15.6% ± 5.9%, P < 0.005) ( Fig. 1A). In CFS patients, however, cytotoxicity was not significantly increased after a 24-h treatment with 30 mmol L 1L-Arg (1 mmol L 1 L-Arg, 9.4% ± 8.0%; 30 mmol L 1 L-Arg, 7.3% ± 7.4%) ( Fig. 1B). We also examined whether D-Arg could increase NK activity in control subjects and CFS patients. Treatment with D-Arg did not significantly affect NK activity in either control subjects (n = 7) or CFS patients (n = 7) ( Fig. 1C and D), indicating that the stimulatory effect of Arg on NK activity was specific to L-Arg. These results indicate that the L-Arg-induced activation of NK function was suppressed in CFS patients.

Detectable expression of iNOS transcripts in PBMCs in both control subjects and CFS patients

In a previous study, the stimulating effects of NK cytotoxicity were attributed to a higher rate of Arg metabolism leading, in turn, to an increase in nitrite produced from L-Arg by iNOS [ 18]. We analysed the expression of iNOS transcripts in PBMCs by means of RT-PCR, to determine whether the endogenous production of NO differs between control subjects and CFS patients. As shown in Fig. 2, the PBMCs from control subjects and CFS patients expressed mRNA of iNOS at comparable levels, as detected in DLD-1 a human colon cancer cell line, which expresses iNOS [ 29]. Therefore, both CFS-derived and control-derived PBMCs are able to produce NO from L-Arg.

Suppression of L-Arg-induced NK activity and NO-mediated NK activity in CFS patients

We analysed the effect of L-NMMA, a specific inhibitor for NOS, on the L-Arg-mediated activation of NK function to determine if NK activity is mediated by NO through iNOS. As shown in Fig. 3A, L-NMMA decreased the L-Arg-induced enhancement of NK activity in control subjects (n = 6, P < 0.05), whereas L-NMMA had no significant effect on NK activity in CFS patients (n = 7) ( Fig. 3B). The addition of L-NMMA alone to the cultures of PBMCs from control subjects or CFS patients had no effect on NK activity (data not shown). L-NMMA specifically decreased NK activity enhanced by L-Arg, suggesting that the stimulatory effect of L-Arg on NK activity is mediated by NO in the control subjects, and that the NO-mediated NK activity was considerably suppressed in CFS patients.

To confirm further the stimulatory effect of NO on NK activity, SNAP was added to PBMC cultures. Preincubation with 10 mol L 1 SNAP for 24 h enhanced NK activity in control subjects (n = 7, 15.1% ± 5.4% vs. 19.4% ± 8.7%, P < 0.05) ( Fig. 3C), whereas it had no significant effect in CFS patients (n = 7) ( Fig. 3D). This supports the hypothesis that L-Arg-induced NK activation is mediated by NO in control subjects, and also suggests that NO-mediated NK activation may be impaired in CFS patients.

No difference in the NK lymphocyte subset, as judged by flow cytometry
We next examined the proportion of an NK lymphocyte subset, defined as CD3 CD56+ cells [ 24], before and after treatment with 30 mmol L 1L-Arg. In control subjects and CFS patients, the proportions of NK cells in PBMCs were 14.7% ± 4.6% (n = 9) and 12.1% ± 4.7% (n = 8) before L-Arg treatment respectively, indicating that the proportion of NK cells was not significantly different between control subjects and CFS patients.

After incubation with 30 mmol L 1 L-Arg for 24 h, the proportions of NK cells were 16.5% ± 5.9% and 12.3% ± 5.1% in control subjects and CFS patients respectively ( Fig. 4). This suggests that treatment with L-Arg did not affect the proportion of NK cells, and that the L-Arg induction increased NK activity in control subjects independently of the proportion of NK cells.

Cytokine production from the PBMCs of control subjects and CFS patients after L-Arg treatment

NK cells are activated by several cytokines, which are produced by activated lymphocytes, such as IL-1 , IL-2, and IFN- [ 30-32]. We examined whether incubation with L-Arg could induce the release of these three cytokines from the PBMCs in control subjects and CFS patients. After incubation with 30 mmol L 1L-Arg for 24 h, the levels of IL-1 in the supernatants from the PBMCs were increased, but no significant difference was observed between control subjects and CFS patients ( Fig. 5A and B). With regard to IFN- , no significant increase after incubation with 30 mmol L 1L-Arg ( Fig. 5C and D) was observed. IL-2 also behaved similarly (data not shown). These results indicate that pretreatment with L-Arg stimulated the production of cytokines in the PBMCs in control subjects and also indicate that the impaired effect of L-Arg on NK activity induction in CFS patients is not due to a defect in cytokine production arising from their PBMCs.

Discussion

In the present study, NK activity was significantly increased after a 24-h treatment with L-Arg in control subjects, but not with D-Arg. Moreover, L-NMMA abolished the NK activation that had been induced by L-Arg pretreatment, and the pretreatment of PBMCs with exogenous NO supplied by SNAP increased the NK activity in control subjects. These findings show that the NK activation that arises by pretreatment of PBMCs with L-Arg is mediated by NO, which is generated from L-Arg by iNOS, and raises the possibility that NO may function not only as a cytotoxic molecule [ 18, 33], but also as an activator of NK cells.

In CFS patients, however, little or no change in NK cell activity was observed in response to L-Arg or SNAP-derived NO. Furthermore, the inhibition of iNOS by L-NMMA had no influence on the NK activity in CFS patients. Our RT-PCR study showed that the PBMCs from both control subjects and CFS patients expressed iNOS transcripts in a similar degree. Collectively, these results suggest that the impaired L-Arg-induced NK activation in CFS may be attributable to abnormalities in the response to NO.

We next examined the effects of L-Arg on the proportion of NK cells and the production of cytokines, as it has been reported that NO may affect cytokine generation [ 34]. A positive feedback mechanism has been reported, in which NO enhances the synthesis of several cytokines and, in turn, stimulates NO generation [ 35]. The addition of 30 mmol L 1L-Arg to the cultures markedly elevated IL-1 production in some cases of the control subjects and the CFS patients, although no correlation was noted between NK activity and cytokine level in the supernatants from PBMCs cultures. These results suggest that the enhancement of NK activity by L-Arg pretreatment might be explained by stimulation of cytokine production induced by the L-Arg/NO pathway.

Alternatively, NO might directly stimulate NK cells via changing the intracellular second messenger such as cGMP or other mechanisms. Recent reports have shown that NO is implicated as a signaling substance and modifies various enzyme activities through the binding to the iron molecule of their co-factors or by interacting with a thiol group to form a nitrosocompound [ 36-38].

The aetiological significance of persistent or reactivation of various viruses in associated with a variety of immunological abnormalities in CFS patients is controversial. Therefore, this impaired NO-mediated NK activation may be a consequence rather than a cause of CFS. Despite the lack of any significant abnormality of NK activity in the absence of stimulation by PBMCs, NO-mediated NK activation was found to be impaired in the CFS patients. NO-mediated NK activation can be an objective evidence for functional impairment of NK cells in CFS subjects.

The biological significance of NO-mediated NK activation is unknown in the immune system. L-Arg supplementation to a bearing-bearing host leads to the suppression of cancer growth [ 39, 40]. Furthermore, recent studies have shown that NO has cytotoxic effects as tumoricidal or antimicrobial molecules [ 20, 33] and inhibitory effects on viral infections by inhibiting viral DNA synthesis, or inducing and/or activating other antiviral factors, such as interferons, inside cells [ 41, 42]. These observations suggest the NO-mediated NK activation may play an important role in the immune defense system. Further studies will be necessary to clarify the biological and clinical significance of NO-mediated NK activation. These findings may be a clue to clarify the pathogenesis of CFS.

Acknowledgements

This work was supported, in part, by Grants-in-aid from the Ministry of Health and Welfare of Japan.


References:

1. Holmes GP, Kaplan JE, Gantz NM, et alChronic fatigue syndrome: A working case definition. Ann Intern Med 1988; 108: 387 9.

2. Dickinson CJ. Chronic fatigue syndrome-aetiological aspects. Eur J Clin Invest 1997; 27: 257 67.

3. Behan PO, Behan WMH, Bell EJ. The post-viral fatigue syndrome an analysis of the findings in 50 cases. J Infect 1985; 10: 211 22.

4. Yousef GE, Bell EJ, Mann GF, et alChronic enterovirus infection with post-viral fatigue syndrome. Lancet 1988; i: 146 9.

5. DeFreitas E, Hilliard B, Cheney PR, et alRetroviral sequences related to human T-lymphotropic virus type II in patients with chronic fatigue immune dysfunction syndrome. Proc Natl Acad Sci USA 1991; 88: 2922 6.

6. Holmes GP, Kaplan JE, Stewart JA, Hunt B, Pinsky PF, Schonberger LB. A cluster of patients with a chronic mononucleosis-like syndrome: is Epstein-Barr virus the cause?JAMA 1987; 257: 2297 302.

7. Nakaya T, Takahashi H, Nakamura Y, et alDemonstration of Borna disease virus RNA in peripheral blood mononuclear cells derived from Japanese patients with chronic fatigue syndrome. FEBS Lett 1996; 378: 145 9.

8. Barker E, Fujimura SF, Fadem MB, Landay AL, Levy JA. Immunologic abnormalities associated with chronic fatigue syndrome. Clin Infec Dis 1994; 18(Suppl. 1): S136 41.

9. Caligiuri M, Murray C, Buchwald D, et alPhenotypic and functional deficiency of natural killer cells in patients with chronic fatigue syndrome. J Immunol 1987; 139: 3306 13.

10. Klimas NG, Salvato FR, Morgan R, Fletcher MA. Immunologic abnormalities in chronic fatigue syndrome. J Clin Microbiol 1990; 28: 1403 10.

11. Swanink CMA, Melchers WJG, Van der Meer JWM, et alEnteroviruses and the chronic fatigue syndrome. Clin Infect Dis 1994; 19: 860 4.

12. Swanink CMA, Van der Meer JWM, Vercoulen Jhmm, Bleijenberg G, Fennis JHF, Galama JMD. Epstein-Barr virus (EBV) and the chronic fatigue syndrome: normal virus load in blood and normal immunologic reactivity in the EBV regression assay. Clin Infect Dis 1995; 20: 1390 2.

13. Swanink CMA, Vercoulen Jhmm, Galama JMD, et alLymphocyte subsets, apoptosis, and cytokines in patients with chronic fatigue syndrome. J Infect Dis 1996; 173: 460 3.

14. Welsh RM. Natural cell mediated immunity during virus infection. In: Haller O. eds. Natural Resistance to Tumor and Viruses. Berlin: Springer-Verlag 1981: 83.

15. Ojo-Amaize EA, Conley EJ, Peter JB. Decreased natural killer cell activity is associated with severity of chronic fatigue immune dysfunction syndrome. Clinic Infec Dis 1994; 18(Suppl. 1): S157 9.

16. Buchwald D&Komaroff AL. Review of laboratory findings for patients with chronic fatigue syndrome. Rev Infec Dis 1991; 13(Suppl. 1): S12 8.

17. Barbul A. Arginine: biochemistry, physiology, and therapeutic implications. J Parenteral Enteral Nutr 1986; 10: 227 38.

18. Cifone MG, Festuccia C, Cironi L, et alInduction of the nitric oxide-synthesizing pathway in fresh and interleukin 2-cultured rat natural killer cells. Cell Immunol 1994; 157: 181 94.

19. Park KG, Hayes PD, Garlick PJ, Sewell H, Eremin O. Stimulation of lymphocyte natural cytotoxicity by L-arginine. Lancet 1991; 337: 645 6.

20. Hibbs JB Jr , Taintor RR, Varvrin Z. Macrophage cytotoxicity: role for L-arginine deiminase and imino nitrogen oxidation to nitrite. Science 1987; 235: 473 6.

21. Moncada S, Palmer RMJ, Higgs EA. Biosynthesis of nitric oxide from L-Arginine: a pathway for the regulation of cell function and communication. Biochem Pharmacol 1989; 38: 1709 15.

22. Ignarro LJ, Lippton H, Edwards JC, et alMechanism of vascular smooth muscle relaxation by organic nitrates, nitrites, nitroprusside and nitric oxide: Evidence for the involvement of S-nitrosothiols as active intermediates. J Pharmacol Exp Ther 1981; 218: 739 49.

23. Boyum A. Separation of leukocytes from blood and bone marrow. Scand J Clin Lab Invest 1968; 21(Suppl. 97): 9 89.

24. Schmidt RE, Murray C, Daley JF, Schlossman SF, Ritz J. A subset of natural killer cells in peripheral blood displays a mature T cell phenotype. J Exp Med 1986; 164: 351 6.

25. Korzeniewski C&Callewart D. An enzyme-release assay for natural cytotoxicity. J Immunol Methods 1983; 64: 313 20.

26. Sambrook J, Fritsch E, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989.

27. Mannick JB, Asano K, Izumi K, Kieff E, Stamler JS. Nitric oxide produced by human B lymphocytes inhibits apoptosis and Epstein-Barr Virus reaction. Cell 1994; 79: 1137 46.

28. Rees DD, Palmer RMJ, Schulz R, Hodson HF, Moncada S. Characterization of three inhibitors of endothelial nitric oxide synthase in vitro and in vivo. Br J Pharmacol 1990; 101: 746 52.

29. Nussler AK, Silvio MD, Billiar TR, et alStimulation of the nitric oxide synthase pathway in human hepatocytes by cytokines and endotoxin. J Exp Med 1992; 176: 261 4.

30. Sherman PA, Laubach VE, Reep BR, Wood ER. Purification and cDNA sequence of an inducible nitric oxide synthase from a human tumor cell line. Biochemistry 1993; 32: 11600 5.

31. Ding AH, Nathan CF, Stuehr DJ. Release of reactive nitrogen intermediates and reactive oxygen intermediates from mouse peritoneal macrophage: comparison of activating cytokines and evidence for independent production. J Immunol 1988; 141: 2407 12.

32. Drapier JC, Wietzerbin J, Hibbs JBInterferon- and tumor necrosis factor induce the L-arginine-dependent cytotoxic effector mechanism in murine macrophage. Eur J Immunol 1988; 18: 1587 92.

33. Xiao L, Eneroth PHE, Qureshi GA. Nitric oxide synthase pathway may mediate cell cytotoxicity. Scand J Immunol 1995; 42: 505 11.

34. Taylor-Robinson AW, Liew FY, Severn A, et alRegulation of the immune response by nitric oxide differentially produced by T helper type 1 and T helper type 2 cells. Eur J Immunol 1994; 24: 980 4.

35. Marcinkiewicz JZ, Grabowska A, Chain B. Nitric oxide up-regulates the release of inflammatory mediators by mouse macrophages. Eur J Immunol 1995; 25: 947 51.

36. Moncada S, Palmer RMJ, Higgs EA. Nitric oxide: physiology, pathology, and pharmacology. Pharmacol Rev 1991; 43: 109 42.

37. Stamler JS, Singel DJ, Loscalzo J. Biochemistry of nitric oxide and its redox-activated forms. Science 1898-90; 1992; 258: 2.

38. Stamler JS. Redox signaling: nitrosylation and related target interactions of nitric oxide. Cell 1994; 78: 931 6.

39. Reynolds JV, Daly JM, Shou J, Sigal R, Ziegler MM, Naji A. Immunologic effects of arginine supplementation in tumor bearing and non-tumor bearing hosts. Ann Surg 1990; 211: 202 10.

40. Daly JM, Reynolds J, Thom A, et alImmune and metabolic effects of arginine in the surgical patient. Ann Surg 1988; 208: 512 23.

41. Bi Z&Reiss CS. Inhibition of vesicular stomatitis virus infection by nitric oxide. J Virol 1995; 69: 2208 13.

42. Karupiah G, Xie Q, Buller RML, Nathan C, Duarte C, MacMicking JD. Inhibition of viral replication by interferon induced nitric oxide synthase. Science 1993; 261: 1445 8.



Post a Comment

Featured Products From the ProHealth Store
Vitamin D3 Extreme™ Energy NADH™ 12.5mg Mitochondria Ignite™ with NT Factor®

Looking for Vitamins, Herbs and Supplements?
Search the ProHealth Store for Hundreds of Natural Health Products


Article Comments



Be the first to comment on this article!

Post a Comment


 
Natural Pain Relief Supplements

Featured Products

Vitamin D3 Extreme™ Vitamin D3 Extreme™
50,000 IU Vitamin D3 - Prescription Strength
Ultra ATP+, Double Strength Ultra ATP+, Double Strength
Get energized with malic acid & magnesium
Optimized Curcumin Longvida® Optimized Curcumin Longvida®
Supports Cognition, Memory & Overall Health
Energy NADH™ 12.5mg Energy NADH™ 12.5mg
Improve Energy & Cognitive Function
Mitochondria Ignite™ with NT Factor® Mitochondria Ignite™ with NT Factor®
Reduce Fatigue up to 45%

Natural Remedies

Health Benefits Are Brewing in Green Tea Health Benefits Are Brewing in Green Tea
The Crucial Role CoQ10 Plays in Fibromyalgia and ME/CFS The Crucial Role CoQ10 Plays in Fibromyalgia and ME/CFS
Herbal Inflammation Management for Whole Body Health Herbal Inflammation Management for Whole Body Health
Block Acid Reflux to Prevent Esophageal Problems! Block Acid Reflux to Prevent Esophageal Problems!
Cell-Charging Compound Gives Steady Energy to Fibromyalgia & Chronic Fatigue Patients Cell-Charging Compound Gives Steady Energy to Fibromyalgia & Chronic Fatigue Patients

CONTACT US
ProHealth, Inc.
555 Maple Ave
Carpinteria, CA 93013
(800) 366-6056  |  Email

· Become a Wholesaler
· Vendor Inquiries
· Affiliate Program
SHOP WITH CONFIDENCE
Credit Card Processing
SUBSCRIBE AND SAVE 15% NOW*
Be the first to know about new products, special discounts and the latest health news. *New subscribers only

CONNECT WITH US ProHealth on Facebook  ProHealth on Twitter  ProHealth on Pinterest  ProHealth on Google Plus

© 2016 ProHealth, Inc. All rights reserved. Pain Tracker App  |  Store  |  Customer Service  |  Guarantee  |  Privacy  |  Contact Us  |  Library  |  RSS  |  Site Map